lastdb
======

This program prepares sequences for subsequent comparison and
alignment using lastal.  You can use it like this::

  lastdb humanDb humanChromosome*.fasta

This will read files called ``humanChromosome*.fasta``, and write
several files whose names begin with ``humanDb``.

Input
-----

The input should be one or more files in fasta format, which looks
like this::

  >MyFirstSequence
  ATCGGGATATATGGAGAGCTTAGAG
  TTTGGATATG
  >My2ndSequence
  TTTAGAGGGTTCTTCGGGATT

You can also pipe sequences into lastdb, for example::

  zcat humanChromosome*.fasta.gz | lastdb humanDb

Options
-------

Main Options
~~~~~~~~~~~~

  -h, --help
      Show all options and their default settings, and exit.

  -p  Interpret the sequences as proteins.  The default is to interpret
      them as DNA.

  -R DIGITS
      Specify lowercase-marking of repeats, by two digits
      (e.g. "-R01"), with the following meanings.

      First digit:

      0. Convert the input sequences to uppercase while reading them.
      1. Keep any lowercase in the input sequences.

      Second digit:

      0. Do not check for simple repeats.
      1. Convert simple repeats (e.g. cacacacacacacacac) to lowercase.
         This uses tantan (http://www.cbrc.jp/tantan/), which reliably
         prevents non-homologous alignments, unlike other repeat
         finders.
      2. Convert simple DNA repeats to lowercase, with tantan tuned
         for ~80% AT-rich genomes.

  -c  Soft-mask lowercase letters.  This means that, when we compare
      these sequences to some other sequences using lastal, lowercase
      letters will be excluded from initial matches.  This will apply
      to lowercase letters in both sets of sequences.

  -u NAME
      Specify a seeding scheme.  The -m option will then be ignored.
      The built-in schemes are described in `<last-seeds.html>`_.

      Any other NAME is assumed to be a file name.  For an example of
      the format, see the seed files in the data directory.  You can
      set other lastdb options on lines starting with ``#lastdb``, but
      command line options override them.  You can also set lastal
      options on lines starting with ``#lastal``, which are overridden
      by options from a `scoring scheme <last-matrices.html>`_ or the
      lastal command line.

Advanced Options
~~~~~~~~~~~~~~~~

  -w STEP
      Allow initial matches to start only at every STEP-th position in
      each of the sequences given to lastdb.  This reduces the memory
      usage of lastdb and lastal, and it makes lastdb faster.  Its
      effect on the speed and sensitivity of lastal is not entirely
      clear.

  -W SIZE
      Allow initial matches to start only at positions that are
      "minimum" in any window of SIZE consecutive positions.
      "Minimum" means that the sequence starting here is
      alphabetically earliest.

      The "alphabetical" order depends on the `seed pattern
      <last-seeds.html>`_.  The letter order is determined by the
      order of the letter groups, and letters in the same group are
      considered equivalent.

      The fraction of positions that are "minimum" is roughly: 2 /
      (SIZE + 1).

  -s BYTES      
      Limit memory usage, by splitting the output files into smaller
      "volumes" if necessary.  This will limit the memory usage of
      both lastdb and lastal, but it will make lastal slower.  It is
      also likely to change the exact results found by lastal.

      Each volume will have at most BYTES bytes.  (Roughly.  The more
      masked letters or DNA "N"s, the more it will undershoot.)  You
      can use suffixes K, M, and G to specify KibiBytes, MebiBytes,
      and GibiBytes (e.g. "-s 5G").

      However, the output for one sequence is never split.  Since the
      output files are several-fold bigger than the input (unless you
      use -w), this means that mammalian chromosomes cannot be
      processed using much less than 2G (unless you use -w).

      There is a hard upper limit of about 4 billion sequence letters
      per volume.  Together with the previous point, this means that
      lastdb will refuse to process any single sequence longer than
      about 4 billion.

  -Q NUMBER
      Specify the input format.  0 means fasta, 1 means fastq-sanger,
      2 means fastq-solexa, and 3 means fastq-illumina.  The fastq
      formats provide sequence quality data, which will be stored by
      lastdb and then used by lastal.  These formats are described in
      `<lastal.html>`_.

  -P THREADS
      Divide the work between this number of threads running in
      parallel.  0 means use as many threads as your computer claims
      it can handle simultaneously.  Currently, multi-threading is
      used for tantan masking only.

  -m PATTERN
      Specify a spaced seed pattern, for example "-m 110101".  In this
      example, mismatches will be allowed at every third and fifth
      position out of six in initial matches.

      This option does not constrain the length of initial matches.
      The pattern will get cyclically repeated as often as necessary
      to cover any length.

      Although the 0 positions allow mismatches, they exclude
      non-standard letters (e.g. non-ACGT for DNA).  If option -c is
      used, they also exclude lowercase letters.

      You can also specify transition constraints, e.g "-m 100TT1".
      In this example, transitions (but not transversions) will be
      allowed at every fourth and fifth position out of six.
      Alternatively, you can use Iedera's notation, for example
      "-m '#@#--##--#-#'" ('#' for match, '@' for transition, '-' or
      '_' for mismatch).

      You can specify multiple patterns by separating them with commas
      and/or using "-m" multiple times.

  -a SYMBOLS
      Specify your own alphabet, e.g. "-a 0123".  The default (DNA)
      alphabet is equivalent to "-a ACGT".  The protein alphabet (-p)
      is equivalent to "-a ACDEFGHIKLMNPQRSTVWY".  Non-alphabet
      letters are allowed in sequences, but by default they are
      excluded from initial matches and get the mismatch score when
      aligned to anything.  If -a is specified, -p is ignored.

  -i MATCHES
      This option makes lastdb faster, at the expense of limiting your
      options with lastal.  If you use (say) "-i 10", then you cannot
      use lastal with option m < 10.

  -b DEPTH
      Specify the depth of "buckets" used to accelerate initial match
      finding.  Larger values increase the memory usage of lastdb and
      lastal, make lastal faster, and have no effect on lastal's
      results.  The default is to use the maximum depth that consumes
      at most one byte per possible match start position.

  -C NUMBER
      Specify the type of "child table" to make: 0 means none, 1 means
      byte-size (uses a little more memory), 2 means short-size (uses
      somewhat more memory), 3 means full (uses a lot more memory).
      Choices > 0 make lastal a bit faster, but make lastdb slower,
      and have no effect on lastal's results.  Some tests suggest that
      -C2 is a good choice: faster than -C1 and no slower than -C3.

  -x  Just count sequences and letters.  This is much faster.  Letter
      counting is never case-sensitive.

  -v  Be verbose: write messages about what lastdb is doing.

  -V, --version
      Show version information, and exit.

Limitations
-----------

lastdb can become catastrophically slow for highly redundant
sequences, e.g. two almost-identical genomes.  It usually processes
several GB per hour, but if it becomes much slower, try option "-i
10", which is likely to solve the problem.  (If even that is too slow,
try "-i 100" or so.)
