biom-format.org

biom-format.org

Contents

The Biological Observation Matrix (BIOM) format

The BIOM file format (canonically pronounced biome) is designed to be a general-use format for representing biological sample by observation contingency tables. BIOM is a recognized standard for the Earth Microbiome Project and is a Genomics Standards Consortium candidate project.

The BIOM format is designed for general use in broad areas of comparative -omics. For example, in marker-gene surveys, the primary use of this format is to represent OTU tables: the observations in this case are OTUs and the matrix contains counts corresponding to the number of times each OTU is observed in each sample. With respect to metagenome data, this format would be used to represent metagenome tables: the observations in this case might correspond to SEED subsystems, and the matrix would contain counts corresponding to the number of times each subsystem is observed in each metagenome. Similarly, with respect to genome data, this format may be used to represent a set of genomes: the observations in this case again might correspond to SEED subsystems, and the counts would correspond to the number of times each subsystem is observed in each genome.

There are two components to the BIOM project: first is the definition of the BIOM format, and second is development of support objects in multiple programming languages to support the use of BIOM in diverse bioinformatics applications. The version of the BIOM file format is independent of the version of the biom-format software.

There are official implementations of BIOM format support objects (APIs) in the Python and R programming languages. The rest of this site contains details about the BIOM file format (which is independent of the API) and the Python biom-format API. For more details about the R API, please see the CRAN biom package.

Contents

BIOM Documentation

These pages provide format specifications and API information for the BIOM table objects.

The biom file format

The BIOM project consists of two independent tools: the biom-format software package, which contains software tools for working with BIOM-formatted files and the tables they represent; and the BIOM file format. As of the 1.0.0 software version and the 1.0 file format version, the version of the software and the file format are independent of one another. Version specific documentation of the file formats can be found on the following pages.

The biom file format: Version 1.0

The biom format is based on JSON to provide the overall structure for the format. JSON is a widely supported format with native parsers available within many programming languages.

Required top-level fields:

id                  : <string or null> a field that can be used to id a table (or null)
format              : <string> The name and version of the current biom format
format_url          : <url> A string with a static URL providing format details
type                : <string> Table type (a controlled vocabulary)
                      Acceptable values:
                       "OTU table"
                       "Pathway table"
                       "Function table"
                       "Ortholog table"
                       "Gene table"
                       "Metabolite table"
                       "Taxon table"
generated_by        : <string> Package and revision that built the table
date                : <datetime> Date the table was built (ISO 8601 format)
rows                : <list of objects> An ORDERED list of obj describing the rows
                      (explained in detail below)
columns             : <list of objects> An ORDERED list of obj  describing the columns
                      (explained in detail below)
matrix_type         : <string> Type of matrix data representation (a controlled vocabulary)
                      Acceptable values:
                       "sparse" : only non-zero values are specified
                       "dense" : every element must be specified
matrix_element_type : Value type in matrix (a controlled vocabulary)
                      Acceptable values:
                       "int" : integer
                       "float" : floating point
                       "unicode" : unicode string
shape               : <list of ints>, the number of rows and number of columns in data
data                : <list of lists>, counts of observations by sample
                       if matrix_type is "sparse", [[row, column, value],
                                                    [row, column, value],
                                                    ...]
                       if matrix_type is "dense",  [[value, value, value, ...],
                                                    [value, value, value, ...],
                                                    ...]

Optional top-level fields:

comment             : <string> A free text field containing any information that you
                       feel is relevant (or just feel like sharing)

The rows value is an ORDERED list of objects where each object corresponds to a single row in the matrix. Each object can currently store arbitrary keys, although this might become restricted based on table type. Each object must provide, at the minimum:

id                  : <string> an arbitrary UNIQUE identifier
metadata            : <an object or null> A object containing key, value metadata pairs

The columns value is an ORDERED list of objects where each object corresponds to a single column in the matrix. Each object can currently store arbitrary keys, although this might become restricted based on table type. Each object must provide, at the minimum:

id                  : <string> an arbitrary UNIQUE identifier
metadata            : <an object or null> A object containing key, value metadata pairs
Example biom files

Below are examples of minimal and rich biom files in both sparse and dense formats. To decide which of these you should generate for new data types, see the section on Tips and FAQs regarding the BIOM file format.

Minimal sparse OTU table
{
    "id":null,
    "format": "Biological Observation Matrix 0.9.1-dev",
    "format_url": "http://biom-format.org/documentation/format_versions/biom-1.0.html",
    "type": "OTU table",
    "generated_by": "QIIME revision 1.4.0-dev",
    "date": "2011-12-19T19:00:00",
    "rows":[
            {"id":"GG_OTU_1", "metadata":null},
            {"id":"GG_OTU_2", "metadata":null},
            {"id":"GG_OTU_3", "metadata":null},
            {"id":"GG_OTU_4", "metadata":null},
            {"id":"GG_OTU_5", "metadata":null}
        ],
    "columns": [
            {"id":"Sample1", "metadata":null},
            {"id":"Sample2", "metadata":null},
            {"id":"Sample3", "metadata":null},
            {"id":"Sample4", "metadata":null},
            {"id":"Sample5", "metadata":null},
            {"id":"Sample6", "metadata":null}
        ],
    "matrix_type": "sparse",
    "matrix_element_type": "int",
    "shape": [5, 6],
    "data":[[0,2,1],
            [1,0,5],
            [1,1,1],
            [1,3,2],
            [1,4,3],
            [1,5,1],
            [2,2,1],
            [2,3,4],
            [2,4,2],
            [3,0,2],
            [3,1,1],
            [3,2,1],
            [3,5,1],
            [4,1,1],
            [4,2,1]
           ]
}
Minimal dense OTU table
{
    "id":null,
    "format": "Biological Observation Matrix 0.9.1-dev",
    "format_url": "http://biom-format.org/documentation/format_versions/biom-1.0.html",
    "type": "OTU table",
    "generated_by": "QIIME revision 1.4.0-dev",
    "date": "2011-12-19T19:00:00",
    "rows":[
            {"id":"GG_OTU_1", "metadata":null},
            {"id":"GG_OTU_2", "metadata":null},
            {"id":"GG_OTU_3", "metadata":null},
            {"id":"GG_OTU_4", "metadata":null},
            {"id":"GG_OTU_5", "metadata":null}
        ],
    "columns": [
            {"id":"Sample1", "metadata":null},
            {"id":"Sample2", "metadata":null},
            {"id":"Sample3", "metadata":null},
            {"id":"Sample4", "metadata":null},
            {"id":"Sample5", "metadata":null},
            {"id":"Sample6", "metadata":null}
        ],
    "matrix_type": "dense",
    "matrix_element_type": "int",
    "shape": [5,6],
    "data":  [[0,0,1,0,0,0],
              [5,1,0,2,3,1],
              [0,0,1,4,2,0],
              [2,1,1,0,0,1],
              [0,1,1,0,0,0]]
}
Rich sparse OTU table
{
 "id":null,
 "format": "Biological Observation Matrix 0.9.1-dev",
 "format_url": "http://biom-format.org/documentation/format_versions/biom-1.0.html",
 "type": "OTU table",
 "generated_by": "QIIME revision 1.4.0-dev",
 "date": "2011-12-19T19:00:00",
 "rows":[
    {"id":"GG_OTU_1", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}},
    {"id":"GG_OTU_2", "metadata":{"taxonomy":["k__Bacteria", "p__Cyanobacteria", "c__Nostocophycideae", "o__Nostocales", "f__Nostocaceae", "g__Dolichospermum", "s__"]}},
    {"id":"GG_OTU_3", "metadata":{"taxonomy":["k__Archaea", "p__Euryarchaeota", "c__Methanomicrobia", "o__Methanosarcinales", "f__Methanosarcinaceae", "g__Methanosarcina", "s__"]}},
    {"id":"GG_OTU_4", "metadata":{"taxonomy":["k__Bacteria", "p__Firmicutes", "c__Clostridia", "o__Halanaerobiales", "f__Halanaerobiaceae", "g__Halanaerobium", "s__Halanaerobiumsaccharolyticum"]}},
    {"id":"GG_OTU_5", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}}
    ],
 "columns":[
    {"id":"Sample1", "metadata":{
                             "BarcodeSequence":"CGCTTATCGAGA",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"gut",
                             "Description":"human gut"}},
    {"id":"Sample2", "metadata":{
                             "BarcodeSequence":"CATACCAGTAGC",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"gut",
                             "Description":"human gut"}},
    {"id":"Sample3", "metadata":{
                             "BarcodeSequence":"CTCTCTACCTGT",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"gut",
                             "Description":"human gut"}},
    {"id":"Sample4", "metadata":{
                             "BarcodeSequence":"CTCTCGGCCTGT",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"skin",
                             "Description":"human skin"}},
    {"id":"Sample5", "metadata":{
                             "BarcodeSequence":"CTCTCTACCAAT",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"skin",
                             "Description":"human skin"}},
    {"id":"Sample6", "metadata":{
                             "BarcodeSequence":"CTAACTACCAAT",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"skin",
                             "Description":"human skin"}}
            ],
 "matrix_type": "sparse",
 "matrix_element_type": "int",
 "shape": [5, 6],
 "data":[[0,2,1],
         [1,0,5],
         [1,1,1],
         [1,3,2],
         [1,4,3],
         [1,5,1],
         [2,2,1],
         [2,3,4],
         [2,5,2],
         [3,0,2],
         [3,1,1],
         [3,2,1],
         [3,5,1],
         [4,1,1],
         [4,2,1]
        ]
}
Rich dense OTU table
{
 "id":null,
 "format": "Biological Observation Matrix 0.9.1-dev",
 "format_url": "http://biom-format.org/documentation/format_versions/biom-1.0.html",
 "type": "OTU table",
 "generated_by": "QIIME revision 1.4.0-dev",
 "date": "2011-12-19T19:00:00",
 "rows":[
    {"id":"GG_OTU_1", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}},
    {"id":"GG_OTU_2", "metadata":{"taxonomy":["k__Bacteria", "p__Cyanobacteria", "c__Nostocophycideae", "o__Nostocales", "f__Nostocaceae", "g__Dolichospermum", "s__"]}},
    {"id":"GG_OTU_3", "metadata":{"taxonomy":["k__Archaea", "p__Euryarchaeota", "c__Methanomicrobia", "o__Methanosarcinales", "f__Methanosarcinaceae", "g__Methanosarcina", "s__"]}},
    {"id":"GG_OTU_4", "metadata":{"taxonomy":["k__Bacteria", "p__Firmicutes", "c__Clostridia", "o__Halanaerobiales", "f__Halanaerobiaceae", "g__Halanaerobium", "s__Halanaerobiumsaccharolyticum"]}},
    {"id":"GG_OTU_5", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}}
    ],
 "columns":[
    {"id":"Sample1", "metadata":{
                             "BarcodeSequence":"CGCTTATCGAGA",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"gut",
                             "Description":"human gut"}},
    {"id":"Sample2", "metadata":{
                             "BarcodeSequence":"CATACCAGTAGC",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"gut",
                             "Description":"human gut"}},
    {"id":"Sample3", "metadata":{
                             "BarcodeSequence":"CTCTCTACCTGT",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"gut",
                             "Description":"human gut"}},
    {"id":"Sample4", "metadata":{
                             "BarcodeSequence":"CTCTCGGCCTGT",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"skin",
                             "Description":"human skin"}},
    {"id":"Sample5", "metadata":{
                             "BarcodeSequence":"CTCTCTACCAAT",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"skin",
                             "Description":"human skin"}},
    {"id":"Sample6", "metadata":{
                             "BarcodeSequence":"CTAACTACCAAT",
                             "LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
                             "BODY_SITE":"skin",
                             "Description":"human skin"}}
            ],
 "matrix_type": "dense",
 "matrix_element_type": "int",
 "shape": [5,6],
 "data":  [[0,0,1,0,0,0],
           [5,1,0,2,3,1],
           [0,0,1,4,2,0],
           [2,1,1,0,0,1],
           [0,1,1,0,0,0]]
}

Release versions contain three integers in the following format: major-version.incremental-version.minor-version. When -dev is appended to the end of a version string that indicates a development (or between-release version). For example, 1.0.0-dev would refer to the development version following the 1.0.0 release.

Tips and FAQs regarding the BIOM file format

Should I generate sparse or dense biom files?

In general, we recommend using the sparse format for your biom files. These will be a lot smaller than the dense format biom files when your data is sparse (i.e., more than 85% of your counts are zero). This is common for OTU tables and metagenome tables, and you’ll want to investigate whether it’s true for your data. If you currently format your data in tab-separated tables where observations are rows and samples are columns, you can format that file to be convertible to biom format with the biom convert command. Here you can create dense and sparse formats, and see which file size is smaller. See the section on Converting between file formats.

Motivation for the BIOM format

The BIOM format was motivation by several goals. First, to facilitate efficient handling and storage of large, sparse biological contingency tables; second, to support encapsulation of core study data (contingency table data and sample/observation metadata) in a single file; and third, to facilitate the use of these tables between tools that support this format (e.g., passing of data between QIIME, MG-RAST, and VAMPS.).

Efficient handling and storage of very large tables

In QIIME, we began hitting limitations with OTU table objects when working with thousands of samples and hundreds of thousands of OTUs. In the near future we expect that we’ll be dealing with hundreds of thousands of samples in single analyses.

The OTU table format up to QIIME 1.4.0 involved a dense matrix: if an OTU was not observed in a given sample, that would be indicated with a zero. We now primarily represent OTU tables in a sparse format: if an OTU is not observed in a sample, there is no count for that OTU. The two ways of representing this data are exemplified here.

A dense representation of an OTU table:

OTU ID PC.354  PC.355  PC.356
OTU0   0   0   4
OTU1   6   0   0
OTU2   1   0   7
OTU3   0   0   3

A sparse representation of an OTU table:

PC.354 OTU1 6
PC.354 OTU2 1
PC.356 OTU0 4
PC.356 OTU2 7
PC.356 OTU3 3

OTU table data tends to be sparse (e.g., greater than 90% of counts are zero, and frequently as many as 99% of counts are zero) in which case the latter format is more convenient to work with as it has a smaller memory footprint. Both of these representations are supported in the biom-format project via dense and sparse Table types. Generally if less than 85% of your counts are zero, a dense representation will be more efficient.

Encapsulation of core study data (OTU table data and sample/OTU metadata) in a single file

The JSON-format OTU table allow for storage of arbitrary amounts of sample and OTU metadata in a single file. Sample metadata corresponds to what is generally found in QIIME mapping files. At this stage inclusion of this information in the OTU table file is optional, but it may be useful for sharing these files with other QIIME users and for publishing or archiving results of analyses. OTU metadata (generally a taxonomic assignment for an OTU) is also optional. In contrast to the previous OTU table format, you can now store more than one OTU metadata value in this field, so for example you can score taxonomic assignments based on two different taxonomic assignment approaches.

Facilitating the use of tables between tools that support this format

Different tools, such as QIIME, MG-RAST, and VAMPS work with similar data structures that represent different types of data. An example of this is a metagenome table that could be generated by MG-RAST (where for example, columns are metagenomes and rows are functional categories). Exporting this data from MG-RAST in a suitable format will allow for the application of many of the QIIME tools to this data (such as generation of alpha rarefaction plots or beta diversity ordination plots). This new format is far more general than previous formats, so will support adoption by groups working with different data types and is already being integrated to support transfer of data between QIIME, MG-RAST, and VAMPS.

File extension

We recommend that BIOM files use the .biom extension.

biom-format Table objects

The biom-format project provides rich Table objects to support use of the BIOM file format. The objects encapsulate matrix data (such as OTU counts) and abstract the interaction away from the programmer. This provides the immediate benefit of the programmer not having to worry about what the underlying data object is, and in turn allows for different data representations to be supported. Currently, biom-format supports a dense object built off of numpy.array (NumPy) and a sparse object built off of Python dictionaries.

biom-format table_factory method

Generally, construction of a Table subclass will be through the table_factory method. This method facilitates any necessary data conversions and supports a wide variety of input data types.

Description of available Table objects

There are multiple objects available but some of them are unofficial abstract base classes (does not use the abc module for historical reasons). In practice, the objects used should be the derived Tables such as SparseOTUTable or DenseGeneTable.

Abstract base classes

Abstract base classes establish standard interfaces for subclassed types and provide common functionality for derived types.

Table

Table is a container object and an abstract base class that provides a common and required API for subclassed objects. Through the use of private interfaces, it is possible to create public methods that operate on the underlying datatype without having to implement each method in each subclass. For instance, Table.iterSamplesData will return a generator that always yields numpy.array vectors for each sample regardless of how the table data is actually stored. This functionality results from derived classes implementing private interfaces, such as Table._conv_to_np.

OTUTable

The OTUTable base class provides functionality specific for OTU tables. Currently, it only provides a static private member variable that describes its BIOM type. This object was stubbed out incase future methods are developed that do not make sense with the context of, say, an MG-RAST metagenomic abundance table. It is advised to always use an object that subclasses OTUTable if the analysis is on OTU data.

PathwayTable

A table type to represent gene pathways.

FunctionTable

A table type to represent gene functions.

OrthologTable

A table type to represent gene orthologs.

GeneTable

A table type to represent genes.

MetaboliteTable

A table type to represent metabolite profiles.

TaxonTable

A table type to represent taxonomies.

Container classes

The container classes implement required private member variable interfaces as defined by the Table abstract base class. Specifically, these objects define the ways in which data is moved into and out of the contained data object. These are fully functional and usable objects, however they do not implement table type specifc functionality.

SparseTable

The subclass SparseTable can be derived for use with table data. This object implemented all of the required private interfaces specified by the Table base class. The object contains a _data private member variable that is an instance of the current sparse backend. It is advised to used derived objects of SparseTable if the data being operated on is sparse.

DenseTable

The DenseTable object fulfills all private member methods stubbed out by the Table base class. The dense table contains a private member variable that is an instance of numpy.array. The array object is a matrix that contains all values including zeros. It is advised to use this table only if the number of samples and observations is reasonble. Unfortunately, it isn’t reasonable to define reasonable in this context. However, if either the number of observations or the number of samples is > 1000, it would probably be a good idea to rely on a SparseTable.

Table type objects

The table type objects define variables and methods specific to a table type. These inherit from a Container Class and a table type base class, and are therefore instantiable. Generally you’ll instantiate tables with biom.table.table_factory, and one of these will be passed as the constructor argument.

DenseOTUTable
SparseOTUTable
DensePathwayTable
SparsePathwayTable
DenseFunctionTable
SparseFunctionable
DenseOrthologTable
SparseOrthologTable
DenseGeneTable
SparseGeneTable
DenseMetaboliteTable
SparseMetaboliteTable

Converting between file formats

The convert command in the biom-format project can be used to convert between biom and tab-delimited table formats. This is useful for several reasons:
  • converting biom format tables to tab-delimited tables for easy viewing in programs such as Excel
  • converting between sparse and dense biom formats

Note

The tab-delimited tables are commonly referred to as the classic format tables, while BIOM formatted tables are referred to as biom tables.

General usage examples

Convert a tab-delimited table to sparse biom format. Note that you must specify the type of table here:

biom convert -i table.txt -o table.from_txt.biom --table-type="otu table"

Convert a tab-delimited table to dense biom format:

biom convert -i table.txt -o table.dense.biom --table-type="otu table" --matrix-type=dense

Convert biom format to tab-delimited table format:

biom convert -i table.biom -o table.from_biom.txt -b

Convert dense biom format to sparse biom format:

biom convert -i table.dense.biom -o table.sparse.biom --dense-biom-to-sparse-biom

Convert sparse biom format to dense biom format:

biom convert -i table.sparse.biom -o table.dense.biom --sparse-biom-to-dense-biom

Convert biom format to classic format, including the taxonomy observation metadata as the last column of the classic format table. Because the BIOM format can support an arbitrary number of observation (or sample) metadata entries, and the classic format can support only a single observation metadata entry, you must specify which of the observation metadata entries you want to include in the output table:

biom convert -i table.biom -o table.from_biom_w_taxonomy.txt -b --header-key taxonomy

Convert biom format to classic format, including the taxonomy observation metadata as the last column of the classic format table, but renaming that column as ConsensusLineage. This is useful when using legacy tools that require a specific name for the observation metadata column.:

biom convert -i table.biom -o table.from_biom_w_consensuslineage.txt -b --header-key taxonomy --output-metadata-id "ConsensusLineage"

Special case usage examples

Converting QIIME 1.4.0 and earlier OTU tables to BIOM format

If you are converting a QIIME 1.4.0 or earlier OTU table to BIOM format, there are a few steps to go through. First, for convenience, you might want to rename the ConsensusLineage column taxonomy. You can do this with the following command:

sed 's/Consensus Lineage/ConsensusLineage/' < otu_table.txt | sed 's/ConsensusLineage/taxonomy/' > otu_table.taxonomy.txt

Then, you’ll want to perform the conversion including a step to convert the taxonomy string from the classic OTU table to a taxonomy list, as it’s represented in QIIME 1.4.0-dev and later:

biom convert -i otu_table.taxonomy.txt -o otu_table.from_txt.biom --table-type="otu table" --process-obs-metadata taxonomy

Adding sample and observation metadata to biom files

Frequently you’ll have an existing BIOM file and want to add sample and/or observation metadata to it. For samples, metadata is frequently environmental or technical details about your samples: the subject that a sample was collected from, the pH of the sample, the PCR primers used to amplify DNA from the samples, etc. For observations, metadata is frequently a categorization of the observation: the taxonomy of an OTU, or the EC hierarchy of a gene. You can use the biom add-metadata command to add this information to an existing BIOM file.

To get help with add-metadata you can call:

biom add-metadata -h

This command takes a BIOM file, and corresponding sample and/or observation mapping files. The following examples are used in the commands below. You can find these files in the biom-format/examples directory.

Your BIOM file might look like the following:

{
    "id":null,
    "format": "Biological Observation Matrix 1.0.0-dev",
    "format_url": "http://biom-format.org",
    "type": "OTU table",
    "generated_by": "some software package",
    "date": "2011-12-19T19:00:00",
    "rows":[
            {"id":"GG_OTU_1", "metadata":null},
            {"id":"GG_OTU_2", "metadata":null},
            {"id":"GG_OTU_3", "metadata":null},
            {"id":"GG_OTU_4", "metadata":null},
            {"id":"GG_OTU_5", "metadata":null}
        ],
    "columns": [
            {"id":"Sample1", "metadata":null},
            {"id":"Sample2", "metadata":null},
            {"id":"Sample3", "metadata":null},
            {"id":"Sample4", "metadata":null},
            {"id":"Sample5", "metadata":null},
            {"id":"Sample6", "metadata":null}
        ],
    "matrix_type": "sparse",
    "matrix_element_type": "int",
    "shape": [5, 6],
    "data":[[0,2,1],
            [1,0,5],
            [1,1,1],
            [1,3,2],
            [1,4,3],
            [1,5,1],
            [2,2,1],
            [2,3,4],
            [2,5,2],
            [3,0,2],
            [3,1,1],
            [3,2,1],
            [3,5,1],
            [4,1,1],
            [4,2,1]
           ]
}

A sample metadata mapping file could then look like the following. Notice that there is an extra sample in here with respect to the above BIOM table. Any samples in the mapping file that are not in the BIOM file are ignored.

#SampleID       BarcodeSequence DOB
# Some optional
# comment lines...
Sample1 AGCACGAGCCTA    20060805
Sample2 AACTCGTCGATG    20060216
Sample3 ACAGACCACTCA    20060109
Sample4 ACCAGCGACTAG    20070530
Sample5 AGCAGCACTTGT    20070101
Sample6 AGCAGCACAACT    20070716

An observation metadata mapping file might look like the following. Notice that there is an extra observation in here with respect to the above BIOM table. Any observations in the mapping file that are not in the BIOM file are ignored.

#OTUID  taxonomy        confidence
# Some optional
# comment lines
GG_OTU_0        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__       0.980
GG_OTU_1        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae        0.665
GG_OTU_2        Root;k__Bacteria        0.980
GG_OTU_3        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae        1.000
GG_OTU_4        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae        0.842
GG_OTU_5        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae        1.000

Adding metadata

To add sample metadata to a BIOM file, you can run the following:

biom add-metadata -i min_sparse_otu_table.biom -o table.w_smd.biom --sample-metadata-fp sam_md.txt

To add observation metadata to a BIOM file, you can run the following:

biom add-metadata -i min_sparse_otu_table.biom -o table.w_omd.biom --observation-metadata-fp obs_md.txt

You can also combine these in a single command to add both observation and sample metadata:

biom add-metadata -i min_sparse_otu_table.biom -o table.w_md.biom --observation-metadata-fp obs_md.txt --sample-metadata-fp sam_md.txt

In the last case, the resulting BIOM file will look like the following:

{
    "columns": [
        {
            "id": "Sample1",
            "metadata": {
                "BarcodeSequence": "AGCACGAGCCTA",
                "DOB": "20060805"
            }
        },
        {
            "id": "Sample2",
            "metadata": {
                "BarcodeSequence": "AACTCGTCGATG",
                "DOB": "20060216"
            }
        },
        {
            "id": "Sample3",
            "metadata": {
                "BarcodeSequence": "ACAGACCACTCA",
                "DOB": "20060109"
            }
        },
        {
            "id": "Sample4",
            "metadata": {
                "BarcodeSequence": "ACCAGCGACTAG",
                "DOB": "20070530"
            }
        },
        {
            "id": "Sample5",
            "metadata": {
                "BarcodeSequence": "AGCAGCACTTGT",
                "DOB": "20070101"
            }
        },
        {
            "id": "Sample6",
            "metadata": {
                "BarcodeSequence": "AGCAGCACAACT",
                "DOB": "20070716"
            }
        }
    ],
    "data": [
        [0, 2, 1.0],
        [1, 0, 5.0],
        [1, 1, 1.0],
        [1, 3, 2.0],
        [1, 4, 3.0],
        [1, 5, 1.0],
        [2, 2, 1.0],
        [2, 3, 4.0],
        [2, 5, 2.0],
        [3, 0, 2.0],
        [3, 1, 1.0],
        [3, 2, 1.0],
        [3, 5, 1.0],
        [4, 1, 1.0],
        [4, 2, 1.0]
    ],
    "date": "2012-12-11T07:36:15.467843",
    "format": "Biological Observation Matrix 1.0.0",
    "format_url": "http://biom-format.org",
    "generated_by": "some software package",
    "id": null,
    "matrix_element_type": "float",
    "matrix_type": "sparse",
    "rows": [
        {
            "id": "GG_OTU_1",
            "metadata": {
                "confidence": "0.665",
                "taxonomy": "Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae"
            }
        },
        {
            "id": "GG_OTU_2",
            "metadata": {
                "confidence": "0.980",
                "taxonomy": "Root;k__Bacteria"
            }
        },
        {
            "id": "GG_OTU_3",
            "metadata": {
                "confidence": "1.000",
                "taxonomy": "Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae"
            }
        },
        {
            "id": "GG_OTU_4",
            "metadata": {
                "confidence": "0.842",
                "taxonomy": "Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae"
            }
        },
        {
            "id": "GG_OTU_5",
            "metadata": {
                "confidence": "1.000",
                "taxonomy": "Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae"
            }
        }
    ],
    "shape": [5, 6],
    "type": "OTU table"
}

Processing metadata while adding

There are some additional parameters you can pass to this command for more complex processing.

You can tell the command to process certain metadata column values as integers (--int-fields), floating point (i.e., decimal or real) numbers (--float-fields), or as hierarchical semicolon-delimited data (--sc-separated).

biom add-metadata -i min_sparse_otu_table.biom -o table.w_md.biom --observation-metadata-fp obs_md.txt --sample-metadata-fp sam_md.txt --int-fields DOB --sc-separated taxonomy --float-fields confidence

Here your resulting BIOM file will look like the following, where DOB values are now integers (compare to the above: they’re not quoted now), confidence values are now floating point numbers (again, not quoted now), and taxonomy values are now lists where each entry is a taxonomy level, opposed to above where they appear as a single semi-colon-separated string.

{
    "columns": [
        {
            "id": "Sample1",
            "metadata": {
                "BarcodeSequence": "AGCACGAGCCTA",
                "DOB": 20060805
            }
        },
        {
            "id": "Sample2",
            "metadata": {
                "BarcodeSequence": "AACTCGTCGATG",
                "DOB": 20060216
            }
        },
        {
            "id": "Sample3",
            "metadata": {
                "BarcodeSequence": "ACAGACCACTCA",
                "DOB": 20060109
            }
        },
        {
            "id": "Sample4",
            "metadata": {
                "BarcodeSequence": "ACCAGCGACTAG",
                "DOB": 20070530
            }
        },
        {
            "id": "Sample5",
            "metadata": {
                "BarcodeSequence": "AGCAGCACTTGT",
                "DOB": 20070101
            }
        },
        {
            "id": "Sample6",
            "metadata": {
                "BarcodeSequence": "AGCAGCACAACT",
                "DOB": 20070716
            }
        }
    ],
    "data": [
        [0, 2, 1.0],
        [1, 0, 5.0],
        [1, 1, 1.0],
        [1, 3, 2.0],
        [1, 4, 3.0],
        [1, 5, 1.0],
        [2, 2, 1.0],
        [2, 3, 4.0],
        [2, 5, 2.0],
        [3, 0, 2.0],
        [3, 1, 1.0],
        [3, 2, 1.0],
        [3, 5, 1.0],
        [4, 1, 1.0],
        [4, 2, 1.0]
    ],
    "date": "2012-12-11T07:30:29.870689",
    "format": "Biological Observation Matrix 1.0.0",
    "format_url": "http://biom-format.org",
    "generated_by": "some software package",
    "id": null,
    "matrix_element_type": "float",
    "matrix_type": "sparse",
    "rows": [
        {
            "id": "GG_OTU_1",
            "metadata": {
                "confidence": 0.665,
                "taxonomy": ["Root", "k__Bacteria", "p__Firmicutes", "c__Clostridia", "o__Clostridiales", "f__Lachnospiraceae"]
            }
        },
        {
            "id": "GG_OTU_2",
            "metadata": {
                "confidence": 0.98,
                "taxonomy": ["Root", "k__Bacteria"]
            }
        },
        {
            "id": "GG_OTU_3",
            "metadata": {
                "confidence": 1.0,
                "taxonomy": ["Root", "k__Bacteria", "p__Firmicutes", "c__Clostridia", "o__Clostridiales", "f__Lachnospiraceae"]
            }
        },
        {
            "id": "GG_OTU_4",
            "metadata": {
                "confidence": 0.842,
                "taxonomy": ["Root", "k__Bacteria", "p__Firmicutes", "c__Clostridia", "o__Clostridiales", "f__Lachnospiraceae"]
            }
        },
        {
            "id": "GG_OTU_5",
            "metadata": {
                "confidence": 1.0,
                "taxonomy": ["Root", "k__Bacteria", "p__Firmicutes", "c__Clostridia", "o__Clostridiales", "f__Lachnospiraceae"]
            }
        }
    ],
    "shape": [5, 6],
    "type": "OTU table"
}

If you have multiple fields that you’d like processed in one of these ways, you can pass a comma-separated list of field names (e.g., --float-fields confidence,pH).

Renaming (or naming) metadata columns while adding

You can also override the names of the metadata fields provided in the mapping files with the --observation-header and --sample-header parameters. This is useful if you want to rename metadata columns, or if metadata column headers aren’t present in your metadata mapping file. If you pass either of these parameters, you must name all columns in order. If there are more columns in the metadata mapping file then there are headers, extra columns will be ignored (so this is also a useful way to select only the first n columns from your mapping file). For example, if you want to rename the DOB column in the sample metadata mapping you could do the following:

biom add-metadata -i min_sparse_otu_table.biom -o table.w_smd.biom --sample-metadata-fp sam_md.txt --sample-header SampleID,BarcodeSequence,DateOfBirth

If you have a mapping file without headers such as the following:

GG_OTU_0        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__       0.980
GG_OTU_1        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae        0.665
GG_OTU_2        Root;k__Bacteria        0.980
GG_OTU_3        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae        1.000
GG_OTU_4        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae        0.842
GG_OTU_5        Root;k__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae        1.000

you could name these while adding them as follows:

biom add-metadata -i min_sparse_otu_table.biom -o table.w_omd.biom --observation-metadata-fp obs_md.txt --observation-header OTUID,taxonomy,confidence

As a variation on the last command, if you only want to include the taxonomy column and exclude the confidence column, you could run:

biom add-metadata -i min_sparse_otu_table.biom -o table.w_omd.biom --observation-metadata-fp obs_md.txt --observation-header OTUID,taxonomy

Sparse matrix backends

As the BIOM project evolves, so do the underlying data structures, leading to potential runtime and memory trade-offs between implementations. The BIOM project currently supports two sparse matrix backends: CSMat and ScipySparseMat. CSMat is the default sparse matrix backend used in the BIOM project.

How to check what sparse matrix backend is in use

To check what sparse matrix backend is in use, simply execute biom show-install-info. The last line shows the SparseObj type. For instance:

$ biom show-install-info

System information
==================
          Platform:    darwin
Python/GCC version:    2.7.1 (r271:86832, Aug 30 2012, 10:07:33)  [GCC 4.2.1 (Based on Apple Inc. build 5658) (LLVM build 2336.11.00)]
 Python executable:    /Users/caporaso/.virtualenvs/biom/bin/python

Dependency versions
===================
    pyqi version:      0.2.0
   NumPy version:      1.7.1
dateutil version:      1.5

biom-format package information
===============================
biom-format version:   1.2.0
     SparseObj type:   CSMat

The last line indicates that the CSMat sparse matrix backend is in use.

Changing the sparse backend

There are two methods to change the backend that is used. The first method is by copying the biom_config file located under support_files/ and placing it in your home directory as ~/.biom_config. Then, edit ~/.biom_config and replace the current backend type with the desired type.

The second method is to set the environment variable $BIOM_CONFIG_FP to a file path of your choice, and place the following line into that file:

python_code_sparse_backend      <BACKEND TYPE>

Where <BACKEND TYPE> is replaced by the specific backend implementation to use.

Sparse matrix backend descriptions

Different sparse matrix backends have different performance characteristics. As the BIOM project changes over time, additional backends may be added that address specific performance concerns.

CSMat

The default sparse matrix backend is CSMat. CSMat is a pure-Python implementation of coordinate list, compressed sparse row and compressed sparse column formats and facilitates interaction with these representations. CSMat is recommended if you are unable to install scipy, which is a required dependency when using ScipySparseMat.

ScipySparseMat

ScipySparseMat is a relatively lightweight Python wrapper around scipy’s sparse matrix library (scipy.sparse). You will need to have scipy installed if you plan to use this backend. In general, expect to see performance improvements in both runtime and overall memory consumption when using this backend, especially with larger sparse BIOM tables (e.g., thousands of samples and/or observations).

Summarizing BIOM tables

If you have an existing BIOM file and want to compile a summary of the information in that table, you can use the biom summarize-table command.

To get help with biom summarize-table you can call:

biom summarize-table -h

This command takes a BIOM file or gzipped BIOM file as input, and will print a summary of the count information on a per-sample basis to the new file specified by the -o parameter. The example file used in the commands below can be found in the biom-format/examples directory.

Summarizing sample data

To summarize the per-sample data in a BIOM file, you can run:

biom summarize-table -i rich_sparse_otu_table.biom -o rich_sparse_otu_table_summary.txt

The following information will be written to rich_sparse_otu_table_summary.txt:

Num samples: 6
Num observations: 5
Total count: 27
Table density (fraction of non-zero values): 0.5000
Table md5 (unzipped): e0d1194d2d94ea81994c93b8f0db7f51

Counts/sample summary:
 Min: 3
 Max: 7
 Median: 4.0
 Mean: 4.5
 Std. dev.: 1.5
 Sample Metadata Categories: LinkerPrimerSequence; BarcodeSequence; Description; BODY_SITE
 Observation Metadata Categories: taxonomy

Counts/sample detail:
 Sample2: 3
 Sample5: 3
 Sample3: 4
 Sample6: 4
 Sample4: 6
 Sample1: 7

As you can see, general summary information about the table is provided, including the number of samples, the number of observations, the total count (i.e., the sum of all values in the table), and so on, followed by the per-sample counts.

Summarizing sample data qualitatively

To summarize the per-sample data in a BIOM file qualitatively, where the number of unique observations per sample (rather than the total count of observations per sample) are provided, you can run:

biom summarize-table -i rich_sparse_otu_table.biom --qualitative -o rich_sparse_otu_table_qual_summary.txt

The following information will be written to rich_sparse_otu_table_qual_summary.txt:

Num samples: 6
Num observations: 5
Table md5 (unzipped): e0d1194d2d94ea81994c93b8f0db7f51

Observations/sample summary:
 Min: 1
 Max: 4
 Median: 2.5
 Mean: 2.5
 Std. dev.: 0.957427107756
 Sample Metadata Categories: LinkerPrimerSequence; BarcodeSequence; Description; BODY_SITE
 Observation Metadata Categories: taxonomy

Observations/sample detail:
 Sample5: 1
 Sample1: 2
 Sample4: 2
 Sample2: 3
 Sample6: 3
 Sample3: 4

The BIOM Format License

The BIOM Format project is licensed under the terms of the Modified BSD
License (also known as New or Revised BSD), as follows:

Copyright (c) 2011-2013, The BIOM Format Development Team <gregcaporaso@gmail.com>

All rights reserved.

Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions are met:
    * Redistributions of source code must retain the above copyright
      notice, this list of conditions and the following disclaimer.
    * Redistributions in binary form must reproduce the above copyright
      notice, this list of conditions and the following disclaimer in the
      documentation and/or other materials provided with the distribution.
    * Neither the name of the BIOM Format Development Team nor the names of its
      contributors may be used to endorse or promote products derived from this
      software without specific prior written permission.

THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND
ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED
WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE
DISCLAIMED. IN NO EVENT SHALL THE BIOM FORMAT DEVELOPMENT TEAM BE LIABLE FOR
ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES
(INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES;
LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND
ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.

The following banner should be used in any source code file to indicate the
copyright and license terms:

#-----------------------------------------------------------------------------
# Copyright (c) 2011-2013, The BIOM Format Development Team.
#
# Distributed under the terms of the Modified BSD License.
#
# The full license is in the file COPYING.txt, distributed with this software.
#-----------------------------------------------------------------------------

BIOM version

The latest official version of the biom-format project is 1.3.1 and of the BIOM file format is 1.0. Details on the file format can be found here.

Installing the biom-format project

To install the biom-format project, you can download the latest version here, or work with the development version. Generally we recommend working with the release version as it will be more stable, but if you want access to the latest features (and can tolerate some instability) you should work with the development version.

The biom-format project has the following dependencies:
  • Python >= 2.7 and < 3.0
  • numpy >= 1.3.0
  • pyqi 0.3.1
  • dateutil (optional; must be installed if using the biom validate-table command)
  • scipy (optional; must be installed if using the ScipySparseMat sparse matrix backend)

The easiest way to install the latest version of the biom-format project and its required dependencies is via pip:

pip install biom-format

That’s it!

If you decided not to install biom-format using pip, it is also possible to manually install the latest release. We’ll illustrate the install process in the $HOME/code directory. You can either work in this directory on your system (creating it, if necessary, by running mkdir $HOME/code) or replace all occurrences of $HOME/code in the following instructions with your working directory. Change to this directory to start the install process:

cd $HOME/code

Download the latest release, which can be found here. After downloading, unpack and install (note: x.y.z refers to the downloaded version):

tar xzf biom-format-x.y.z.tar.gz
cd $HOME/code/biom-format-x.y.z

Alternatively, to install the development version, pull it from GitHub, and change to the resulting directory:

git clone git://github.com/biom-format/biom-format.git
cd $HOME/code/biom-format

To install (either the development or release version), follow these steps:

sudo python setup.py install

If you do not have sudo access on your system (or don’t want to install the biom-format project in the default location) you’ll need to install the library code and scripts in specified directories, and then tell your system where to look for those files. You can do this as follows:

echo "export PATH=$HOME/bin/:$PATH" >> $HOME/.bashrc
echo "export PYTHONPATH=$HOME/lib/:$PYTHONPATH" >> $HOME/.bashrc
mkdir -p $HOME/bin $HOME/lib/
source $HOME/.bashrc
python setup.py install --install-scripts=$HOME/bin/ --install-purelib=$HOME/lib/ --install-lib=$HOME/lib/

You should then have access to the biom-format project. You can test this by running the following command:

python -c "from biom import __version__; print __version__"

You should see the current version of the biom-format project.

Next you can run:

which biom

You should get a file path ending with biom printed to your screen if it is installed correctly. Finally, to see a list of all biom commands, run:

biom

Enabling tab completion of biom commands

The biom command referenced in the previous section is a driver for commands in biom-format, powered by pyqi. You can enable tab completion of biom command names and command options (meaning that when you begin typing the name of a command or option you can auto-complete it by hitting the tab key) by following a few simple steps from the pyqi documentation. While this step is optional, tab completion is very convenient so it’s worth enabling.

To enable tab completion, follow the steps outlined under Configuring bash completion in the pyqi install documentation, substituting biom for my-project and my_project in all commands. After completing those steps and closing and re-opening your terminal, auto-completion should be enabled.

BIOM format in R

There is also a BIOM format package for R, called biom. This package includes basic tools for reading biom-format files, accessing and subsetting data tables from a biom object, as well as limited support for writing a biom-object back to a biom-format file. The design of this API is intended to match the python API and other tools included with the biom-format project, but with a decidedly “R flavor” that should be familiar to R users. This includes S4 classes and methods, as well as extensions of common core functions/methods.

To install the latest stable release of the biom package enter the following command from within an R session:

install.packages("biom")

To install the latest development version of the biom package, enter the following lines in an R session:

install.packages("devtools") # if not already installed
library("devtools")
install_github("biom", "joey711")

Please post any support or feature requests and bugs to the biom issue tracker.

See the biom project on GitHub for further details, or if you would like to contribute.

Note that the licenses between the biom R package (GPL-2) and the other biom-format software (Modified BSD) are different.

Citing the BIOM project

You can cite the BIOM format as follows:

The Biological Observation Matrix (BIOM) format or: how I learned to stop worrying and love the ome-ome.
Daniel McDonald, Jose C. Clemente, Justin Kuczynski, Jai Ram Rideout, Jesse Stombaugh, Doug Wendel, Andreas Wilke, Susan Huse, John Hufnagle, Folker Meyer, Rob Knight, and J. Gregory Caporaso.
GigaScience, June 2012.

Development team

The biom-format project was conceived of and developed by the QIIME, MG-RAST, and VAMPS development groups to support interoperability of our software packages. If you have questions about the biom-format project you can contact gregcaporaso@gmail.com.

Contents