Metadata-Version: 1.0
Name: umis
Version: 1.0.6
Summary: Package for estimating UMI counts in Transcript Tag Counting data.
Home-page: https://github.com/vals/umis
Author: Valentine Svensson
Author-email: valentine@nxn.se
License: UNKNOWN
Description: # umis
        
        
        **umis** provides tools for estimating expression in RNA-Seq data which performs
        sequencing of end tags of transcript, and incorporate molecular tags to
        correct for amplification bias.
        
        There are four steps in this process.
        
         1. Formatting reads
         2. Filtering noisy cellular barcodes
         3. Pseudo-mapping to cDNAs
         4. Counting molecular identifiers
        
        ## 1. Formatting reads
        
        We want to strip out all non-biological segments of the sequenced reads for
        the sake of mapping. While also keeping this information for later use. We
        consider non-biological information such as Cellular Barcode and Molecular
        Barcode. To later be able to extract the optional CB and the MB these are put
        in the read header, with the following format.
        
            @HWI-ST808:130:H0B8YADXX:1:1101:2088:2222:CELL_GGTCCA:UMI_CCCT
            AGGAAGATGGAGGAGAGAAGGCGGTGAAAGAGACCTGTAAAAAGCCACCGN
            +
            @@@DDBD>=AFCF+<CAFHDECII:DGGGHGIGGIIIEHGIIIGIIDHII#
        
        The command `umis fastqtransform` is for transforming a (pair of) read(s) to
        this format based on a _transform file_. The transform file is a json file
        which has a Python flavored regular expression for each read, made to extract
        the necessary components of the reads.
        
        ## 2. Filtering noisy cellular barcodes
        Not all cellular barcodes identified in the transformation will be real. Some
        will be low abundance barcodes that do not represent an actual cell. Others
        will be barcodes that don't come from a set of known barcodes. The `umi cb_filter`
        command can be used to filter a transformed FASTQ file, dropping unknown
        barcodes. The `--nedit` option can be supplied to correct barcodes `--nedit`
        distance away from known barcodes. After barcode filtering,
        the `umis cb_histogram` command will generate a file of counts for
        each cellular barcode. This file can be used to find a count cut-off for barcodes
        that are high abundance for downstream quantitation.
        
        ## 3. Pseudo-mapping to cDNAs
        
        This is done by pseudo-aligners, either Kallisto or RapMap. The SAM (or BAM) file output
        from these tools need to be saved.
        
        ## 4. Counting molecular identifiers
        
        The final step is to infer which cDNA was the origin of the tag a UMI was
        attached to. We use the pseudo-alignments to the cDNAs, and consider a tag
        assigned to a cDNA as a partial _evidence_ for a (cDNA, UMI) pairing. For
        actual counting, we only count unique UMIs for (gene, UMI) pairings with
        sufficient evidence.
        
        To count, use the command `umis tagcount`. This requires a SAM or BAM file as input.
        
        By default, the read name will be used to cell barcodes and UMI sequences. Optionally,
        when using the `--parse_tags` option, the `CR` and `UM` bam tags will be used to
        extract the cell barcode and UMI, respectively.
        
        The recommended workflow is to map reads to cDNA, in which case the target name in the BAM
        will be a transcript ID. If the BAM has been mapped to a genome (e.g. with STAR) `tagcount`
        can use the optional `GX` BAM tag to get the gene name. In this case, use the option `--gene_tags`.
        
        ## kallisto
        The quantitation used in `umis` handles reads that could come from multiple
        transcripts by assigning a fractional count to each transcript and then
        filtering for a minimum count at the end. Many single-cell analyses use
        something similar to this type of counting, but it has drawbacks
        (see
        [this paper](https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0970-8)).
        For more principled UMI quantification,
        see [Kallisto](https://github.com/pachterlab/kallisto). kallisto needs the files
        in a certain format: each cellular barcode has its own FASTQ file and a file
        that lists the UMI for each read. The `umis kallisto` command can reformat your
        fastq files to that format.
        
Platform: UNKNOWN
